Top » Catalog » J1 » FGC17483

$18.00

FGC17483
[FGC17483]

FGC17483
hg38 Position: ChrY:12187901..12187901
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1c (not listed)
Comments: Below ZS227 > FGC13864
Forward Primer: FGC17483_F GGCAGGAAGGGAAGGTTG
Reverse Primer: FGC17483_R CTAAGGTGGTTGGAGCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies