Top » Catalog » J1 » FGC38649

$18.00

FGC38649
[FGC38649]

FGC38649
hg38 Position: ChrY:21612294..21612294
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC37850
Forward Primer: FGC38649_F ATGCTGCATGAGAACAGTGC
Reverse Primer: FGC38649_R GGAGTGCTCAAACCTCAAGC
Reviews

Customers who bought this product also purchased
FGC38648
FGC38648
FGC38645
FGC38645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19272
1 x A23660
1 x FGC9583
1 x ALK354
1 x FGC22555
1 x FGC50884
1 x FGC1715
1 x FGC5426
1 x ALK426
1 x A13633
1 x ALK2
1 x FGC4385
1 x A23500
1 x FGC50010
1 x A20819
1 x FGC4745
1 x FGC4350
1 x ALK455
1 x BY13779
$342.00
Haplogroup Info
Other products
Currencies