Top » Catalog » J1 » FGC38649

$18.00

FGC38649
[FGC38649]

FGC38649
hg38 Position: ChrY:21612294..21612294
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC37850
Forward Primer: FGC38649_F ATGCTGCATGAGAACAGTGC
Reverse Primer: FGC38649_R GGAGTGCTCAAACCTCAAGC
Reviews

Customers who bought this product also purchased
FGC38648
FGC38648
FGC38645
FGC38645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4765
1 x FGC39179
$36.00
Haplogroup Info
Other products
Currencies