Top » Catalog » J1 » FGC4339

$18.00

FGC4339
[FGC4339]

FGC4339
hg38 Position: ChrY:7332042..7332042
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4339_F CATGCGAAAATCTTAGAAAATGC
Reverse Primer: FGC4339_R AGGAGAAAAAGCCCACACAC
Reviews

Customers who bought this product also purchased
FGC4338
FGC4338
FGC4348
FGC4348
FGC4346
FGC4346
FGC4345
FGC4345
FGC4341
FGC4341
FGC4356
FGC4356
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies