Top » Catalog » J1 » FGC4346

$18.00

FGC4346
[FGC4346]

FGC4346
hg38 Position: ChrY:13725474..13725474
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4346_F TGGATAAATTTCTCGACACCTACC
Reverse Primer: FGC4346_R TGAGGATTTTTGTGTCAGTGTTTAC
Reviews

Customers who bought this product also purchased
FGC4345
FGC4345
FGC4341
FGC4341
FGC4340
FGC4340
FGC4356
FGC4356
FGC4339
FGC4339
FGC4351
FGC4351
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38648
1 x A20304
1 x FGC4720
1 x A13635
1 x FGC13864
1 x FGC4358
1 x FGC14446
1 x FGC4356
1 x A15552
1 x ALK193
1 x A18555
1 x FGC38715
1 x FGC37532
1 x ALK80
1 x A11233
1 x FGC43124
$288.00
Haplogroup Info
Other products
Currencies