Top » Catalog » J1 » FGC4348

$18.00

FGC4348
[FGC4348]

FGC4348
hg38 Position: ChrY:14236862..14236862
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4348_F AAGTGGCATGGGTTTTCAAG
Reverse Primer: FGC4348_R TGGGTCTCTTTAATATGGGAATG
Reviews

Customers who bought this product also purchased
FGC4346
FGC4346
FGC4345
FGC4345
FGC4341
FGC4341
FGC4340
FGC4340
FGC4356
FGC4356
FGC4339
FGC4339
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC1731
1 x FGC8703
$36.00
Haplogroup Info
Other products
Currencies