Top » Catalog » J1 » FGC4351

$18.00

FGC4351
[FGC4351]

FGC4351
hg38 Position: ChrY:16520945..16520945
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4351_F TTTCCTCCTCACCATTAGGC
Reverse Primer: FGC4351_R ATAGGGGGATTGGAATCTGG
Reviews

Customers who bought this product also purchased
FGC4340
FGC4340
FGC4356
FGC4356
FGC4339
FGC4339
FGC4348
FGC4348
FGC4338
FGC4338
FGC4346
FGC4346
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47834
1 x ALK877
1 x BY13768
1 x FGC4326
1 x BY108
1 x BY66740
1 x FGC22239
$126.00
Haplogroup Info
Other products
Currencies