Top » Catalog » J1 » FGC37840

$18.00

FGC37840
[FGC37840]

FGC37840
hg38 Position: ChrY:20448295..20448295
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC37840_F AAAGGAACCAGCTTGCACTG
Reverse Primer: FGC37840_R GAATTGATCCTGCCCATTTG
Reviews

Customers who bought this product also purchased
FGC37836
FGC37836
FGC37830
FGC37830
FGC37825
FGC37825
FGC37835
FGC37835
FGC37834
FGC37834
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC37539
1 x BY80
1 x ALK742
$54.00
Haplogroup Info
Other products
Currencies