Top » Catalog » J1 » HU521

$19.00

HU521
[HU521]

HU521
hg38 Position: ChrY:15801366..15801366
Ancestral: T
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC4343
Forward Primer: HU521_F TGAGGAGGAGGAAGAGGAGG
Reverse Primer: HU521_R CACACCCCCAAGGCTGAC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies