Top » Catalog » J1 » FGC4279

$18.00

FGC4279
[FGC4279]

FGC4279
hg38 Position: ChrY:7328108..7328108
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4279_F ACGCTGTGGTTGGAAAATTG
Reverse Primer: FGC4279_R AATTCCAGTGCTTTGGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10492
1 x FGC6538
1 x BY183285
1 x A17833
1 x FGC28714
1 x FGC4351
1 x ALK897
1 x A23679
1 x ALK106
1 x FGC39173
1 x A19211
1 x BY49997
1 x ALK14
1 x BY172199
1 x FGC1714
1 x FGC32851
1 x FGC36738
1 x FGC4346
1 x BY139133
1 x A24929
1 x FGC10032
1 x FGC4294
$396.00
Haplogroup Info
Other products
Currencies