Top » Catalog » J1 » FGC4279

$18.00

FGC4279
[FGC4279]

FGC4279
hg38 Position: ChrY:7328108..7328108
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4279_F ACGCTGTGGTTGGAAAATTG
Reverse Primer: FGC4279_R AATTCCAGTGCTTTGGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4792
$18.00
Haplogroup Info
Other products
Currencies