Top » Catalog » J1 » FGC4297

$18.00

FGC4297
[FGC4297]

FGC4297
hg38 Position: ChrY:20367457..20367457
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4297_F TGTTACCTGAGCAAAAAGAAAAATC
Reverse Primer: FGC4297_R TGCAACCTCTGCTACACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK620
1 x FGC42794
1 x FGC29863
1 x FGC20864
1 x FGC7982
1 x FGC12858
1 x ALK6
1 x FGC4423
$144.00
Haplogroup Info
Other products
Currencies