Top » Catalog » J1 » FGC4297

$18.00

FGC4297
[FGC4297]

FGC4297
hg38 Position: ChrY:20367457..20367457
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4297_F TGTTACCTGAGCAAAAAGAAAAATC
Reverse Primer: FGC4297_R TGCAACCTCTGCTACACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies