Top » Catalog » J1 » A18931

$18.00

A18931
[A18931]

A18931
hg38 Position: ChrY:11530608..11530608
Ancestral: G
Derived: T
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream BY8 > BY9 > BY136 > ZS2003 > ZS2006
Forward Primer: A18931_F AGTGGAGTGGAATGGACGAG
Reverse Primer: A18931_R TCGAATGAATTGTTTTGAGACC
Reviews

Customers who bought this product also purchased
A18937
A18937
FGC57568
FGC57568
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies