Top » Catalog » J1 » A18937

$18.00

A18937
[A18937]

A18937
hg38 Position: ChrY:2976622..2976622
Ancestral: T
Derived: C
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream BY8 > BY9 > BY136 > ZS2003 > ZS2006
Forward Primer: A18937v2_F CAGCGCTGTTGTAGAGATTACTG
Reverse Primer: A18937v2_R GCCAACAGAAACCACTTTCAAC
Reviews

Customers who bought this product also purchased
A18931
A18931
FGC57568
FGC57568
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19278
1 x A13650
1 x ALK567
1 x FGC31373
1 x FGC4743
1 x FGC34531
$108.00
Haplogroup Info
Other products
Currencies