Top » Catalog » J1 » A18939

$18.00

A18939
[A18939]

A18939
hg38 Position: ChrY:21192835..21192835
Ancestral: C
Derived: T
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream BY8 > BY9 > BY136 > ZS2003 > ZS2006 > ZS2010.
Forward Primer: A18939_F TGGGCAAGGATGTAAGTTCC
Reverse Primer: A18939_R GGGGGCAGTGTATGTGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20736
1 x BY65486
1 x FGC40454
1 x BY10490
1 x BY124800
1 x A14643
1 x FGC19465
1 x BY16791
1 x ALK871
1 x ALK864
1 x FGC34536
1 x ALK857
$216.00
Haplogroup Info
Other products
Currencies