Top » Catalog » J1 » A18940

$18.00

A18940
[A18940]

A18940
hg38 Position: ChrY:17177537..17177537
Ancestral: C
Derived: G
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream BY8 > BY9 > BY136 > ZS2003 > ZS2006 > ZS2010.
Forward Primer: A18940_F CACAAGGAGAAGAAGAAGACAGC
Reverse Primer: A18940_R GAGCTTTTAAAAACACAAAAATATTCC
Reviews

Customers who bought this product also purchased
Y94694
Y94694
Y106850
Y106850
Y102964
Y102964
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies