Top » Catalog » J1 » A19161

$18.00

A19161
[A19161]

A19161
hg38 Position: ChrY:15130357..15130357
Ancestral: A
Derived: C
Reference: Had Amli (2017)
ISOGG Haplogroup: J1
Comments: Approx. FGC68217
Forward Primer: A19161_F GATATCCCCCTTGTTATTCTTGC
Reverse Primer: A19161_R GATAGAGATTCTATTGAACAGTTTTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4284
1 x FGC4765
1 x ALK397
1 x BY172422
1 x BY161278
1 x A19269
1 x A19337
1 x FGC29982
1 x A17826
1 x A19270
1 x FGC23314
1 x ALK240
1 x FGC10415
1 x A20306
1 x FGC42830
$270.00
Haplogroup Info
Other products
Currencies