Top » Catalog » J1 » A19263

$18.00

A19263
[A19263]

A19263
hg38 Position: ChrY:7454960..7454960
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19263_F GAGGGTGGAGCCTCATAGG
Reverse Primer: A19263_R TGGAAGGGAACTCAAATTAAAGATG
Reviews

Customers who bought this product also purchased
HU408
HU408
A19281
A19281
A19269
A19269
HU397
HU397
HU402
HU402
A19275
A19275
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies