Top » Catalog » J1 » A19263

$15.00

A19263
[A19263]

A19263
hg38 Position: ChrY:7454960..7454960
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19263_F GAGGGTGGAGCCTCATAGG
Reverse Primer: A19263_R TGGAAGGGAACTCAAATTAAAGATG
Reviews

Customers who bought this product also purchased
HU405
HU405
A19278
A19278
A19264
A19264
FGC64425
FGC64425
HU399
HU399
A19271
A19271
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies