Top » Catalog » J1 » A19263

$18.00

A19263
[A19263]

A19263
hg38 Position: ChrY:7454960..7454960
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19263_F GAGGGTGGAGCCTCATAGG
Reverse Primer: A19263_R TGGAAGGGAACTCAAATTAAAGATG
Reviews

Customers who bought this product also purchased
HU397
HU397
A19269
A19269
HU402
HU402
A19275
A19275
HU407
HU407
A19280
A19280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC50904
1 x FGC8729
1 x BY40604
1 x FGC49174
1 x ALK486
$90.00
Haplogroup Info
Other products
Currencies