Top » Catalog » J1 » A19264

$18.00

A19264
[A19264]

A19264
hg38 Position: ChrY:8195635..8195635
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19264_F CCAAAATGTAAAGATCATTGAGACC
Reverse Primer: A19264_R GTAAGTCTCTAAGGACTTGCTTTATGC
Reviews

Customers who bought this product also purchased
HU403
HU403
A19276
A19276
HU408
HU408
A19281
A19281
HU397
HU397
A19269
A19269
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies