Top » Catalog » J1 » A19264

$18.00

A19264
[A19264]

A19264
hg38 Position: ChrY:8195635..8195635
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19264_F CCAAAATGTAAAGATCATTGAGACC
Reverse Primer: A19264_R GTAAGTCTCTAAGGACTTGCTTTATGC
Reviews

Customers who bought this product also purchased
HU402
HU402
A19275
A19275
HU407
HU407
A19280
A19280
Wish a SNP
Wish a SNP
A19266
A19266
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies