Top » Catalog » J1 » A19266

$18.00

A19266
[A19266]

A19266
hg38 Position: ChrY:11330664..11330664
Ancestral: G
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19266_F CAGAGCCTAGAGAAGAGTTATATGACTG
Reverse Primer: A19266_R TCTACGGGGCATAATGACATATC
Reviews

Customers who bought this product also purchased
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19264
A19264
HU400
HU400
A19272
A19272
HU405
HU405
A19278
A19278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies