Top » Catalog » J1 » A19266

$18.00

A19266
[A19266]

A19266
hg38 Position: ChrY:11330664..11330664
Ancestral: G
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19266_F CAGAGCCTAGAGAAGAGTTATATGACTG
Reverse Primer: A19266_R TCTACGGGGCATAATGACATATC
Reviews

Customers who bought this product also purchased
HU404
HU404
A19277
A19277
HU409
HU409
FGC64421
FGC64421
HU398
HU398
A19270
A19270
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies