Top » Catalog » J1 » A19266

$18.00

A19266
[A19266]

A19266
hg38 Position: ChrY:11330664..11330664
Ancestral: G
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19266_F CAGAGCCTAGAGAAGAGTTATATGACTG
Reverse Primer: A19266_R TCTACGGGGCATAATGACATATC
Reviews

Customers who bought this product also purchased
A22918
A22918
Y154840
Y154840
A22919
A22919
HU401
HU401
A19274
A19274
HU406
HU406
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies