Top » Catalog » J1 » A19266

$18.00

A19266
[A19266]

A19266
hg38 Position: ChrY:11330664..11330664
Ancestral: G
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19266_F CAGAGCCTAGAGAAGAGTTATATGACTG
Reverse Primer: A19266_R TCTACGGGGCATAATGACATATC
Reviews

Customers who bought this product also purchased
HU407
HU407
A19280
A19280
Wish a SNP
Wish a SNP
A19265
A19265
HU401
HU401
A19274
A19274
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10416
1 x FGC6525
1 x FGC38711
1 x FGC10422
1 x FGC4338
1 x BY145
1 x A18553
1 x FGC1722
1 x FGC23929
1 x FGC5428
1 x FGC22248
1 x FGC8716
1 x FGC19506
1 x FGC1701
1 x FGC8726
1 x FGC16654
1 x A13632
1 x FGC23369
1 x FGC4465
1 x ALK480
1 x FGC22238
1 x ALK709
1 x ALK179
1 x FGC50847
$432.00
Haplogroup Info
Other products
Currencies