Top » Catalog » J1 » A19269

$18.00

A19269
[A19269]

A19269
hg38 Position: ChrY:13454914..13454914
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19269_F CCTGAGACCAGGAGTTCGAG
Reverse Primer: A19269_R TTTGCCTGCATTACACCTTG
Reviews

Customers who bought this product also purchased
HU409
HU409
FGC64421
FGC64421
HU398
HU398
A19270
A19270
HU403
HU403
A19276
A19276
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies