Top » Catalog » J1 » A19269

$18.00

A19269
[A19269]

A19269
hg38 Position: ChrY:13454914..13454914
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19269_F CCTGAGACCAGGAGTTCGAG
Reverse Primer: A19269_R TTTGCCTGCATTACACCTTG
Reviews

Customers who bought this product also purchased
HU407
HU407
A19280
A19280
Wish a SNP
Wish a SNP
A19265
A19265
HU401
HU401
A19274
A19274
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies