Top » Catalog » J1 » A19270

$18.00

A19270
[A19270]

A19270
hg38 Position: ChrY:13577011..13577011
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19270_F CTAGCCTGCATGTTCTGCAC
Reverse Primer: A19270_R CTCCCTGACAGGCCTCAAC
Reviews

Customers who bought this product also purchased
HU401
HU401
A19274
A19274
HU406
HU406
A19279
A19279
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19264
A19264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies