Top » Catalog » J1 » A19270

$18.00

A19270
[A19270]

A19270
hg38 Position: ChrY:13577011..13577011
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19270_F CTAGCCTGCATGTTCTGCAC
Reverse Primer: A19270_R CTCCCTGACAGGCCTCAAC
Reviews

Customers who bought this product also purchased
HU399
HU399
A19271
A19271
HU404
HU404
A19277
A19277
HU409
HU409
FGC64421
FGC64421
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies