Top » Catalog » J1 » A19271

$18.00

A19271
[A19271]

A19271
hg38 Position: ChrY:14257133..14257133
Ancestral: T
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19271_F GACAGGGACAAAGGATGGAG
Reverse Primer: A19271_R GCATCCAACATGGGAGAAAG
Reviews

Customers who bought this product also purchased
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19264
A19264
HU400
HU400
A19272
A19272
HU405
HU405
A19278
A19278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC18828
$18.00
Haplogroup Info
Other products
Currencies