Top » Catalog » J1 » A19271

$18.00

A19271
[A19271]

A19271
hg38 Position: ChrY:14257133..14257133
Ancestral: T
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19271_F GACAGGGACAAAGGATGGAG
Reverse Primer: A19271_R GCATCCAACATGGGAGAAAG
Reviews

Customers who bought this product also purchased
HU401
HU401
A19274
A19274
HU406
HU406
A19279
A19279
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19264
A19264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16726
1 x FGC50886
1 x FGC19189
1 x ALK875
1 x FGC6782
1 x FGC5240
1 x ALK4
1 x FGC4342
1 x FGC3747
1 x ALK901
1 x FGC10418
1 x FGC5454
1 x ALK391
1 x FGC10423
1 x FGC1709
1 x A17626
1 x A19277
1 x A19263
1 x BY154830
1 x A13649
1 x A20954
1 x BY25901
1 x FGC4288
1 x ALK96
1 x FGC15762
1 x FGC4767
1 x FGC12
$486.00
Haplogroup Info
Other products
Currencies