Top » Catalog » J1 » A19274

$19.00

A19274
[A19274]

A19274
hg38 Position: ChrY:16679282..16679282
Ancestral: A
Derived: G
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19274_F GGCAATCAGCCATTTGATTC
Reverse Primer: A19274_R AATTGAAGGTGCCGAGAGTC
Reviews

Customers who bought this product also purchased
HU398
HU398
A19269
A19269
HU403
HU403
A19276
A19276
HU408
HU408
A19281
A19281
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies