Top » Catalog » J1 » A19274

$18.00

A19274
[A19274]

A19274
hg38 Position: ChrY:16679282..16679282
Ancestral: A
Derived: G
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19274_F GGCAATCAGCCATTTGATTC
Reverse Primer: A19274_R AATTGAAGGTGCCGAGAGTC
Reviews

Customers who bought this product also purchased
HU400
HU400
A19271
A19271
HU405
HU405
A19278
A19278
A19263
A19263
FGC64425
FGC64425
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies