Top » Catalog » J1 » A19275

$18.00

A19275
[A19275]

A19275
hg38 Position: ChrY:20040653..20040653
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19275_F CCATTTGACCCAGCATTCAG
Reverse Primer: A19275_R GCCATGTTGGTTTACTGCAC
Reviews

Customers who bought this product also purchased
HU401
HU401
A19272
A19272
HU406
HU406
A19279
A19279
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19264
A19264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38645
1 x FGC4295
1 x FGC11723
1 x FGC16666
1 x FGC5225
1 x ALK358
1 x FGC5241
1 x CTS5551
$144.00
Haplogroup Info
Other products
Currencies