Top » Catalog » J1 » A19275

$18.00

A19275
[A19275]

A19275
hg38 Position: ChrY:20040653..20040653
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19275_F CCATTTGACCCAGCATTCAG
Reverse Primer: A19275_R GCCATGTTGGTTTACTGCAC
Reviews

Customers who bought this product also purchased
HU402
HU402
A19274
A19274
HU407
HU407
A19280
A19280
Wish a SNP
Wish a SNP
A19265
A19265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies