Top » Catalog » J1 » A19276

$18.00

A19276
[A19276]

A19276
hg38 Position: ChrY:20568766..20568766
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19276_F CGAAGGAGCTCTTCAAGGTG
Reverse Primer: A19276_R TGTGCTTCTCAGTCCCCTTC
Reviews

Customers who bought this product also purchased
HU397
HU397
A19266
A19266
HU402
HU402
A19274
A19274
HU407
HU407
A19280
A19280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies