Top » Catalog » J1 » A19276

$18.00

A19276
[A19276]

A19276
hg38 Position: ChrY:20568766..20568766
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19276_F CGAAGGAGCTCTTCAAGGTG
Reverse Primer: A19276_R TGTGCTTCTCAGTCCCCTTC
Reviews

Customers who bought this product also purchased
HU406
HU406
A19279
A19279
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19264
A19264
HU400
HU400
A19271
A19271
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK597
1 x A13636
1 x A24499
1 x FGC10411
1 x A19334
1 x FGC14712
1 x FGC19188
1 x ALK3
1 x FGC15940
1 x FGC5231
1 x FGC42789
1 x FGC12860
1 x FGC31164
1 x ALK115
$252.00
Haplogroup Info
Other products
Currencies