Top » Catalog » J1 » A19278

$18.00

A19278
[A19278]

A19278
hg38 Position: ChrY:21200555..21200555
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19278_F TTTCACAATATTGATTCTTCCTATCTGTAAG
Reverse Primer: A19278_R AAAGCTCTCAGTAAACTGGGCC
Reviews

Customers who bought this product also purchased
A19263
A19263
FGC64425
FGC64425
HU399
HU399
A19270
A19270
HU404
HU404
A19276
A19276
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC41681
1 x FGC30611
1 x FGC13066
1 x A24916
1 x ALK301
1 x FGC30712
1 x FGC37835
1 x FGC5431
1 x ALK528
1 x A19280
1 x ALK401
1 x ALK708
1 x A20830
1 x FGC41680
1 x FGC10500
1 x FGC8709
1 x BY6
$306.00
Haplogroup Info
Other products
Currencies