Top » Catalog » J1 » A19279

$18.00

A19279
[A19279]

A19279
hg38 Position: ChrY:26508864..26508864
Ancestral: G
Derived: T
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19279_F CCACTAACAAACCTATGCACACAAC
Reverse Primer: A19279_R CTTGCAGCACATACTTTACACG
Reviews

Customers who bought this product also purchased
HU399
HU399
A19270
A19270
HU404
HU404
A19276
A19276
HU409
HU409
FGC64421
FGC64421
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies