Top » Catalog » J1 » A19280

$18.00

A19280
[A19280]

A19280
hg38 Position: ChrY:26520274..26520274
Ancestral: G
Derived: T
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19280_F TGAAGCTAAAAGATTGGTTCGTGAC
Reverse Primer: A19280_R ATGCTGTGGCAACTTCCC
Reviews

Customers who bought this product also purchased
HU407
HU407
A19279
A19279
Wish a SNP
Wish a SNP
A19265
A19265
HU401
HU401
A19272
A19272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies