Top » Catalog » J1 » A19281

$18.00

A19281
[A19281]

A19281
hg38 Position: ChrY:26630620..26630620
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19281_F AGTTACTGTTTAATGGGTACATAGTTTCTG
Reverse Primer: A19281_R AATATTTCTCCAATATCTTCAAAATTAAAACAG
Reviews

Customers who bought this product also purchased
HU399
HU399
A19270
A19270
A19276
A19276
HU404
HU404
FGC64421
FGC64421
HU409
HU409
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies