Top » Catalog » J1 » A19294

$18.00

A19294
[A19294]

A19294
hg38 Position: ChrY:13186122..13186122
Ancestral: C
Derived: A
Reference: Elfatih Salim (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19294_F TTTCTCCGAGGCACAAAAAC
Reverse Primer: A19294_R TCTGTCACATCTTCCCTTGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies