Top » Catalog » J1 » A19335

$18.00

A19335
[A19335]

A19335
hg38 Position: ChrY:17220841..17220841
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19335_F TCCCCTGCATATGAGGTTTC
Reverse Primer: A19335_R GTGTAACTGCAGCCCTGAGC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS5814
ZS5814
ZS11817
ZS11817
ZS5801
ZS5801
A13649
A13649
FGC1715
FGC1715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies