Top » Catalog » J1 » A19337

$18.00

A19337
[A19337]

A19337
hg38 Position: ChrY:21240753..21240753
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A19337_F TGTGACCTTTCAGTTGTTCAGC
Reverse Primer: A19337_R CCTTCTCTCCTGCCTCTTTTG
Reviews

Customers who bought this product also purchased
A19336
A19336
A19335
A19335
A19334
A19334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies