Top » Catalog » J1 » A19930

$18.00

A19930
[A19930]

A19930
hg38 Position: ChrY:7273064..7273064
Ancestral: C
Derived: G
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS2006 > ZS2010
Forward Primer: A19930_F GACTGGAGACCGCTTTCAG
Reverse Primer: A19930_R CAACCTGATAAAGAACTGTGCAGAC
Reviews

Customers who bought this product also purchased
A19931
A19931
A19929
A19929
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies