Top » Catalog » J1 » A19930

$18.00

A19930
[A19930]

A19930
hg38 Position: ChrY:7273064..7273064
Ancestral: C
Derived: G
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS2006 > ZS2010
Forward Primer: A19930_F GACTGGAGACCGCTTTCAG
Reverse Primer: A19930_R CAACCTGATAAAGAACTGTGCAGAC
Reviews

Customers who bought this product also purchased
A19931
A19931
A19929
A19929
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies