Top » Catalog » J1 » A19931

$18.00

A19931
[A19931]

A19931
hg38 Position: ChrY:14312463..14312463
Ancestral: C
Derived: T
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS2006 > ZS2010
Forward Primer: A19931_F GAGAATACACAACTATGCAAATATTACAAC
Reverse Primer: A19931_R ATAGTATTCGTGTTTAGAGGGCTGTG
Reviews

Customers who bought this product also purchased
A19929
A19929
A19930
A19930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies