Top » Catalog » J1 » A20306

$18.00

A20306
[A20306]

A20306
hg38 Position: ChrY:12609813..12609813
Ancestral: A
Derived: G
Reference: 2018
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20306_F GTGGTGGGAACCTGTAATCC
Reverse Primer: A20306_R CTCTGCCTTCCTGGTTCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies