Top » Catalog » J1 » FGC5425

$18.00

FGC5425
[FGC5425]

FGC5425
hg38 Position: ChrY:12567737..12567737
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5424
Forward Primer: FGC5425_F TCTGAAGCTCCCAGATGAATTC
Reverse Primer: FGC5425_R CCAAATAAGACTCAAACCAAAATTG
Reviews

Customers who bought this product also purchased
FGC5432
FGC5432
FGC5431
FGC5431
FGC5435
FGC5435
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies