Top » Catalog » J1 » FGC10608

$18.00

FGC10608
[FGC10608]

FGC10608
hg38 Position: ChrY:16744595..16744595
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC10585
Forward Primer: FGC10608_F GCAGATTACCTGAGATCAGGAAC
Reverse Primer: FGC10608_R TGCTCTACTGGATGCCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK899
1 x BY13778
1 x ALK18
1 x FGC4420
1 x FGC29979
1 x A20821
1 x BY139864
1 x ALK457
1 x ALK536
1 x FGC1608
1 x FGC37830
1 x FGC4390
1 x A12921
1 x FGC5485
1 x ALK121
1 x ALK860
1 x FGC22262
1 x FGC4755
1 x ALK201
$342.00
Haplogroup Info
Other products
Currencies