Top » Catalog » J1 » FGC10608

$18.00

FGC10608
[FGC10608]

FGC10608
hg38 Position: ChrY:16744595..16744595
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC10585
Forward Primer: FGC10608_F GCAGATTACCTGAGATCAGGAAC
Reverse Primer: FGC10608_R TGCTCTACTGGATGCCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies