Top » Catalog » J1 » FGC10612

$18.00

FGC10612
[FGC10612]

FGC10612
hg38 Position: ChrY:19609063..19609063
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC10585
Forward Primer: FGC10612_F GGTCTCGATCTCTTGACCACAG
Reverse Primer: FGC10612_R GGCGAAGCCACTGAAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies