Top » Catalog » J1 » BY16791

$18.00

BY16791
[BY16791]

BY16791
hg38 Position: ChrY:8204296..8204296
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1695
Forward Primer: BY16791_F AGAAGTTGGTGACCTTGAATGTG
Reverse Primer: BY16791_R AATAACTTAAACAAATTTACAAGAATAAAATAACG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FGC1723
FGC1723
FGC3718
FGC3718
FGC12
FGC12
YSC0000076
YSC0000076
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies