Top » Catalog » J1 » BY16791

$18.00

BY16791
[BY16791]

BY16791
hg38 Position: ChrY:8204296..8204296
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1695
Forward Primer: BY16791_F AGAAGTTGGTGACCTTGAATGTG
Reverse Primer: BY16791_R AATAACTTAAACAAATTTACAAGAATAAAATAACG
Reviews

Customers who bought this product also purchased
FGC11
FGC11
FGC1696
FGC1696
FGC4453
FGC4453
ZS9086
ZS9086
ZS4737
ZS4737
BY68843
BY68843
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies